Genetic mapping

Results: 1084



#Item
61

Optimizing the Performance-Related Configurations of Object-Relational Mapping Frameworks Using a Multi-Objective Genetic Algorithm Ravjot Singh†, Cor-Paul Bezemer†, Weiyi Shang‡, Ahmed E. Hassan† Software Analys

Add to Reading List

Source URL: users.encs.concordia.ca

Language: English - Date: 2016-03-01 09:47:33
    62Epigenetics / Biology / Genetic mapping / Cancer research / Epigenome / PSL Research University / Curie Institute

    GROUP LEADER POSITIONS Institut Curie, Paris The Institut Curie (http://www.curie.fr) is a world-class multidisciplinary cancer research centre linked to an hospital. It combines research in cell biology, genetics, epige

    Add to Reading List

    Source URL: www.enbdc.org

    Language: English - Date: 2016-04-29 08:15:22
    63Biology / Genetics / RNA / Biotechnology / Molecular biology / Genetic mapping / Long non-coding RNA / Rapid amplification of cDNA ends / Non-coding RNA

                                                                Native Purification and Analysis of Long RNAs Isabel Chillón1,2, Marc

    Add to Reading List

    Source URL: www.epigenesys.eu

    Language: English - Date: 2016-05-10 10:16:09
    64Biology / Bioinformatics / Genetics / Genetic mapping / Genomics / Biological databases / KEGG / Systems biology / Coiled coil / Human genome / Gene / Genome

    Functional Classification of Coiled-Coil Proteins in Multiple Genomes Akiyasu C. Yoshizawa1 Masumi Itoh1

    Add to Reading List

    Source URL: www.jsbi.org

    Language: English - Date: 2005-01-21 01:11:34
    65Biology / Genetics / Genomics / Molecular evolution / Molecular genetics / Genetic mapping / Mutation / Genome / Gene duplication / Human genome / Gene / Paleopolyploidy

    Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120

    Add to Reading List

    Source URL: www.jsbi.org

    Language: English - Date: 2004-05-17 21:39:16
    66Genomics / DNA / Molecular biology / Genetic mapping / Genetics / Nasonia vitripennis / Human genome / Genome / Single-nucleotide polymorphism / Western honey bee / Ridge / DNA methylation

    SEE COMMENTARY Draft genome of the globally widespread and invasive Argentine ant (Linepithema humile) Christopher D. Smitha,1, Aleksey Ziminb, Carson Holtc, Ehab Abouheifd, Richard Bentone, Elizabeth Cashf, Vincent Cro

    Add to Reading List

    Source URL: biology.mcgill.ca

    Language: English - Date: 2014-06-10 10:16:58
    67Genetics / Genomics / Genetic mapping / Myrmicinae / DNA / Genome / Nasonia vitripennis / Western honey bee / Ridge / Hymenoptera / Pseudogene / Pogonomyrmex

    SEE COMMENTARY Draft genome of the red harvester ant Pogonomyrmex barbatus Chris R. Smitha,1, Christopher D. Smithb,1, Hugh M. Robertsonc, Martin Helmkampfd, Aleksey Zimine, Mark Yandellf, Carson Holtf, Hao Huf, Ehab Ab

    Add to Reading List

    Source URL: biology.mcgill.ca

    Language: English - Date: 2014-06-10 10:16:59
    68Biology / Genomics / Genetics / Molecular evolution / Genetic mapping / Bioinformatics / Genome / Evolution / Comparative genomics / Horizontal gene transfer / Gene duplication / Gene

    Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name

    Add to Reading List

    Source URL: fellowship.ercim.eu

    Language: English - Date: 2013-02-11 08:41:46
    69Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / Human evolution / Human genetics / Human genome / Conserved sequence / Noncoding DNA / Genome / Comparative genomics

    GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

    Add to Reading List

    Source URL: bejerano.stanford.edu

    Language: English - Date: 2009-04-17 16:28:41
    70Bacteria / Biology / Chroococcales / Synechocystis / Genomics / Genetic mapping / Genome / Cyanobacteria / Model organism

    CyanoBase: Visual presentation of information on the genome of Cyanobacterium Synechocystis sp. strain PCC6803 through WWW Makoto Hirosawa

    Add to Reading List

    Source URL: www.jsbi.org

    Language: English - Date: 1998-01-09 02:50:13
    UPDATE